Molecular phylogeny of grouper of Epinephelus genus in Jayapura, Papua, Indonesia inferred from Cytochrome Oxidase I (COI) gene

##plugins.themes.bootstrap3.article.main##

SUKMA DWIFAJRI
RICARDO F. TAPILATU
https://orcid.org/0000-0001-5216-104X
BAYU PRANATA
ARADEA BUJANA KUSUMA

Abstract

Abstract. Dwifajri S, Tapilatu RF, Pranata B, Kusuma AB. 2022. Molecular phylogeny of grouper of
Epinephelusgenus in Jayapura, Papua, Indonesiainferred from Cytochrome Oxidase I (COI) gene. Biodiversitas 23: 1449-1456. Grouper (Serranidae: Epinephelinae: Epinephelus) fish have high economic value, and are relatively overfis hed, yet have not received serious attention to determine conservation status by the International Union for Conservation of Nature (IUCN). DNA barcoding is an important molecular approach to identify Papua's grouper species. The objective of the present study was to analyze species diversity and molecular phylogeny of Epinephelus grouper based on DNA sequences of mitochondrial control region COI gene. Samples of grouper fish were collected from Hamadi, Sentani, and Youtefa local fish markets in Jayapura, Papua during August 2020. Grouper was morphologically identified, photographed and its fin was clipped and preserved for molecular analysis. Present study used primers, i.e., Fish R1 5'TAGACTTCTGGCCAAGAATCA3' and Fish F1 5'TCAACCAACCACAAAGACATTGGCA3'. Based on gene bank comparison at the sequence length 689 base pairs, the present study obtained seven species of grouper (Serranidae: Epinephelinae), namely Epinephelus areolatus, Epinephelus coioides, Epinephelus episictus, Epinephelus kupangensis, Epinephelus macrospilos, Epinephelus melanostigma and Epinephelus merra. The phylogenetic tree was composed of seven clades, where each grouper species represented each clade. The genetic distance between Epinephelus kupangensis and Epinephelus melanostigma was determined as the closest genetic distance (0.123) in the present study, while the farthest one was found between Epinephelus episictus and Epinephelus merra (0.161).

##plugins.themes.bootstrap3.article.details##

References
Allen GR, Erdmann MV. 2012. Reef Fishes of the East Indies Volumes I-III. Tropical Reef Research, Perth, Australia. ISBN: 978-0-9872600-0-0. 1,292 p.
Akbar N, Aris M, Irfan M, Tahir I, Baksir A. 2018. Kajian filogenetik ikan tuna (Thunnus spp) sebagai data pengelolaan di perairan sekitar Kepulauan Maluku, Indonesia. Jurnal Kelautan 11 (2): 120-129.
Becker RA, Sales NG, Santos GM, Santos GB, Carvalho DC. 2015. DNA barcoding and morphological identification of neotropical ichthyoplankton from the Upper Paraná and São Francisco. J. Fish Biol 87(1):159-68.
Baldauf SL. 2003. Phylogeny for the faint of heart: A tutorial. Genetics 19(6): 345-351.
Bhattacharjee MJ, Laskar BA, Dhar B, Ghosh SK. 2012. Identification and Re-Evaluation of Freshwater Catfishes through DNA Barcoding. PLoS ONE 7(11): e49950.
Campbell NA, Reece JB, Urry LA, Cain ML, Wasserman SA, Minorsky PV, Jackson RB, Wulandari DT. 2010. Biologi. Edisi ke 8 Jilid 1. Erlangga, Jakarta.
Cole AJ, Pratchett MS, Jones GP. 2008. Diversity and functional importance of coral-feeding fishes on tropical coral reefs. Fish and Fisheries 9(3): 286–307.
Craig MT, Mitchesin YJS, Heemstra PC. 2011. Groupers of the World: A Field and Market Guide. NISC.
Government Regulation of the Republic of Indonesia Number 60 Year 2007 Article 2, Concerning Conservation of Fish Resources With the Grace of God Almighty the President of the Republic of Indonesia
Heemstra PC, Randall JE. 1993. Groupers of the world (family Serranidae, sub family Epinephelinae). An Annotated and Illustrated Catalugue of the Grouper, Rockod, Hind, CoralGrouper, and Lyretail Species. FAO Species Catalogue, Rome, Italy.
Hebert PDN, Gregory TR. 2005. The promise of DNA barcoding for taxonomy. Syst. Biol 54: 852-859.
Hollingsworth PM, Graham SW, Little DP. 2011. Choosing and using a plant DNA barcode. PLoS ONE 6: e19254.
Hulley EN, Taylor, ND, Zarnke AM, Somers, CM, Manzon RG, Wilson JY, Boreham DR. 2018. DNA barcoding vs. morphological identification of larval fish and embryos in Lake Huron: Advantages to a molecular approach. J. Great Lakes Res 44: 1110-1116
Johnson J, Bertram I, Chin A, Moore BR, Pratchett M, Welch DJ, Williams A, Bell J, Govan H. 2018. Effects of Climate Change on Fish and Shellfish Relevant to Pacific Islands, and the Coastal Fisheries they Support. Science Review: 74-98
Jefri E, Zamani EP, Subhan B, Madduppa HH. 2015. Molecular phylogeny inferred from mitochondrial DNA of the grouper Epinephelus spp. in Indonesia collected from local fish market. Biodiversitas 16: 254-263.
Jarvis PD. Holland BR, Sumner, JG. 2017. Phylogenetic Invariants and Markov Invariants. Reference Module in Life Sciences: 321-323.
Kashefi P, Bani A, Ebrahimi E. 2012. Morphometric and meristic variations between non-reproductive and reproductive kutum females (Rutilus frisii kutum, Kamensky, 1901), in the southwest Caspian Sea. Italian J Zoo 79(3): 337-343.
Kumar S, Tamura K, Stecher G. 2016. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Molecular Biology and Evolution 33 (7): 1870-1874.
Kamal MM, Hakim AA, Butet NA, Fitrianingsih Y, Astuti R. 2019. Autentikasi spesies ikan kerapu berdasarkan marka gen MT-COI dari perairan Peukan Bada, Aceh. Jurnal Biologi Tropis 19 (2): 116-123.
Kusuma AB, Tapilatu RF, Tururaja TS. 2021. Identifikasi Morfologi Ikan Kerapu (Serranidae: Epinephelinae) Yang Didaratkan Di Waisai Raja Ampat. Jurnal Enggano 6(1): 37 – 46.
Li S, Pearl DK, Doss H. 2000. Phylogenetic Tree Construction using Markov Chain Monte Carlo. Fred Hutchinson Cancer Research Center Washington. J Amer Stat Assoc 95:450-493.
Li Q, Yao J, Zeng L, Lin X, Huang X. 2019. Molecular and morphological evidence for the identity of two nominal species of Astegopteryx (Hemiptera, Aphididae, Hormaphidinae). ZooKeys 833:59-74.
Makarenkov V, Kevorkov D, Legendre P. 2006. Phylogenetic network reconstruction approaches. Appl Mycol Biotechnol 6: 61-97.
Muhiddin AH. 2010. Identifikasi dan klasifikasi kawanan lemuru Selat Baliberdasarkan data hidroakustik dengan metode statistik. Torani (Jurnal Ilmu Kelautan dan Perikanan 20(1): 25-36.
Mavruk S, Saygu I, Bengil F. 2020. Fishers’ responses towards the banning white grouper fishery in Turkey. Journal of Wildlife and Biodiversity Special issue: 50-57.
Nei M. 1972. Genetic distance between population. American Nature 106: 283- 292.
Nybakken JW. 1988. Biologi Laut Suatu Pendekatan Ekologis. Terjemahan M. Ediman, Koesoebiono, D.G Bengen, M. Hutomo, & S. Sukardjo. Jakarta: PT. Gramedia.
Pranata B, Mohamad F, Feni I, Toha AHA, Jeni. 2018. Spiny Lobster Panulirus Versicolor Filogenetic And Genetic In Lombok Waters, West Nusa Tenggara, Indonesia. Biotika 1(20): 37-43.
Paulangan YP, Fahrudin A, Sutrisno D, Bengen DG. 2019. Keanekaragaman dan kemiripan bentuk profil terumbu berdasarkan ikan karang dan lifeform karang di Teluk Depapre Jayapura, Provinsi Papua, Indonesia. Jurnal Ilmu dan Teknologi Kelautan Tropis 11(2): 249–262.
Pei N, Chen B, Kress WJ. 2017. Advances of community-level plant DNA barcoding in China. Front. Plant Sci 8: 225.
Reese ES. 1981. Predation on corals by fishes of the family Chaetodontidae: implications for conservation and management of coral reef ecosystems. Bulletin of Marine Science 31: 594–604.
Rathipriya A, Marx KK, Jawahar P, Lakshmi DK. 2016. Morphometric and meristic analyses of flying fish populations along the Thoothukudi coast, Tamil Nadu. J Aqua Trop 31(1-2): 141-148.
Sachithanandam, Mohan V, Muruganandam PM, Chaaithanya N, Dhivya IK, Baskaran PR. 2012. DNA Barcoding, Phylogenetic Study of Epinephelus spp. from Andaman Coastal Region, India. Indian Journal of Geo-Marine Sciences 41(3): 203-211.
Tamura K. Peterson D, Peterson N, Stecher G, Nei M, Kumar S. 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular biology and evolution 28(10): 2731-2739.
Tapilatu RF, Tururaja TS, Sipriyadi, Kusuma AB. 2021. Molecular Phylogeny Reconstruction of Grouper (Serranidae: Epinephelinae) at Northern Part of Bird’s Head Seascape - Papua Inferred from COI Gene. Fish Aquat Sci 24(5): 181-190.
Tucker S J, Kurniasih EM, Craig MT. 2016. A new species of grouper (Epinephelus; Epinephelidae) from the Indo-Pasific. Copeia 104(3): 658-662.
Veron JEN. 2002. Reef corals of the Raja Ampat Islands, Papua Province, Indonesia, in S.A. McKenna, G.R. & Allen S. Suryadi (eds,), A Marine Rapid Assessment of the Raja Ampat Islands, Papua Province, Indonesia, pp. 26–36, Conservation International, Washington DC.
Wardana IP. 1994. Pembesaran Kerapu Dengan Keramba Jaring Apung. Penebar Swadaya, Jakarta.
Waugh J. 2007. DNA barcoding in animal species: progress, potential and pitfalls. BioEssays 29:188-197.

Most read articles by the same author(s)