Identification of Drought Tolerant and Molecular Analysis of DREB2A and BADH2 Genes and Yield Potensial of Lines from Single Crossing Bengkulu Local Rice Varieties
##plugins.themes.bootstrap3.article.sidebar##
Issue
Section
Articles
##plugins.themes.bootstrap3.article.main##
Abstract
Screening in the seedling stage of 39 progeny of F6 lines to drought stress was carried out in the greenhouse. Drought tolerant and sensitive varieties of IR 20 and Salumpikit, respectively, were used as control plants. The methods for traits identification of leaf curled, dried, and recovery ability after exposure to severe drought for two weeks was following the Standard Evaluation System (SES) developed by IRRI. Molecular analysis to detect the presence of the DREB2A gene was carried out by PCR amplification of genomic DNA using forward- and reverse- oligonucleotide primers of CCTCATTGGGTCAGGAAGAA and GGATCTCAGCCACCCACTTA, respectively, while for BADH2 gene using forward- and reverse- oligonucleotide primers of GGCCAAGTACCTCAAGGCGA and TGTCCCCAGCTGCTTCATCC, respectively. Molecular markers of DREB2A and BADH2 genes were also identified in 39 tested lines with approximately 250 and 2300 bp length, respectively. This study concluded that the progeny of F6 lines generating from the crossing of local varieties of IR7858 and IR148 is the potential to become a drought-tolerant variety of upland rice. Line numbers BKL2 B-2-264-6 and BKL4 B-1-268-10 have a potential yield of more than 12 tonnes/ha. These line has the potential to be developed on rainfed lowland rice or dry land because it has drought resistance.
##plugins.themes.bootstrap3.article.details##
References
Akhtar M, Jaiswal A, Taj G, Jaiswal JP, Qureshi MI, Singh NK. 2012. DREB1/CBF transcription factors: their structure, function and role in abiotic stress tolerance in plants. J. of Genetics 91(3): 385–95.
Bernier J, Kumar A, Ramaiah V, Spaner D, Atlin G. 2007. A large-effect QTL for grain yield under reproductive-stage drought stress in upland rice. Crop Sci. 47:507-517.
Bian Y, Deng X, Yan X, Zhou J, Yuan L, Yan Y. 2017. Integrated proteomic analysis of Brachypodium distachyon roots and leaves reveals a synergistic network in the response to drought stress and recovery. Sci. Reports 7,46183. https://doi.org/10.1038/srep46183
Blum A. 2017. Osmotic adjustment is a prime drought stress adaptive engine in support of plant production. Plant, Cell and Environ. 40:4–10. https://doi.org/10.1111/pce.12800
Bunnag S and Pongthai P. 2013. Selection of rice (Oryza satival.) cultivars tolerant to drought stress at the vegetative stage under field conditions. American J. of Plant Sci, 4:1701-1708.
Cui M, Zhang W, Zhang Q, Xu Z, Zhu Z, Duan F, Wu R. 2011. Induced over-expression of the transcription factor OsDREB2A improves drought tolerance in rice. Plant Physiol. Biochem. 49, 1384–1391. doi: 10.1016/j.plaphy.2011.09.012
Demiral T and Türkan I. 2004. Does exogenous glycinebetaine affect antioxidative system of rice seedlings under NaCl treatment. J. Plant Physiol. 6: 1089-1100.
Mulyaningsih ES, Aswidinnoor H, Sopandie D, Pieter BF, Ouwerkerk, Loedin HIS. 2010. Toleransi genotipe padi gogo dengan marka qtl 12.1 terhadap kekeringan. Jurnal Penelitian Pertanian Tanaman Pangan. 72-81.
Fujita Y, Yoshida T, Yamaguchi SK. 2013. Privotal role of the AREB/ABF-SnRK2 pathway in abremediated transcriptional in response to osmotic stress in plants. Physiol. Plantarum. 147(1): 15–27.
Hasthanasombut S, Paisarnwipatpong N, Triwitayakorn K, Kirdmanee C, Supaibulwatana K. 2011. Expression of OsBADH1 gene in Indica rice (Oryza sativa L.) in correlation with salt, plasmolysis, temperature and light stresses. Plant Omics J. 4(7):400-407.
Herawati R, Masdar, Ganefianti DW, Hermawan B, Alnopri. 2017. Screening and identification of upland rice lines derived recurrent selection for drought tolerance. Intl. J. on Adv. Sci. Eng. Inform Tech. 7(6):2322-2327.
Holmström KO, Somersalo S, Mandal A, Palva TE, Welin B. 2000. Improvement tolerance to salinity and low temperature in transgenic tobacco producing glycine betaine. J Exp Bot. 51: 177-185.
Huang L, Wang Y, Wang W, Zhao X, Qin Q, Sun F, Hu F, Zhao Y, Li Z, Fu B, Li Z. 2018. Characterization of transcription factor gene OsDRAP1 conferring drought tolerance in rice. Front. Plant Sci. 9(94):1-15 doi: 10.3389/fpls.2018.00094
Huang S, Zuo T, Ni W. 2020. Important roles of glycine betaine in stabilizing the structure and function of the photosystem II complex under abiotic stresses. Planta. 251, 36. https://doi.org/10.1007/s00425-019-03330-z
International Rice Research Institute (IRRI). 2002. Standard Evaluation System for Rice. International Rice Testing Program. The International Rice Testing Program (IRTP) IRRI Los Banos, Philippines.
Jadhao KR, Samal KC, Pradhan SK, Rout GR. 2014. Studies on molecular characterization of DREB gene in indica rice (Oryza sativa L.). Hereditary Genet. 3(3): 1–12. DOI:10.4172/2161-1041.1000133.
Kahraman M, Sevim G, Bor M. 2019. The role of proline, glycinebetaine, and trehalose in stress-responsive gene expression. In: Hossain M., Kumar V., Burritt D., Fujita M., Mäkelä P. (eds) Osmoprotectant-Mediated Abiotic Stress Tolerance in Plants. Springer, Cham.
Kumar S, Dwivedi SK, Singh SS, Jha SK, Lekshmy S, Elanchezhian R, Singh ON, and Bhatt BP. 2014. Identification of drought tolerant rice genotypes by analyzing drought tolerance indices and morpho-physiological traits. SABRAO J. of Breed and Gen 46(2):217-230. 2014.
Kumar S, Dwivedi SK, Haris AA, Prakash V, Mondal S, Singh SK. 2015. Screening and identification of rice genotypes for drought tolerance at reproductive stage under rainfed lowland condition. J. of Agri Search 2(2): 105-111.
Kumar S. 2016. Identification of DREB and SSR linked drought sequences in finger millet (Eleusine coracana L.) Gaertn.) genotypes. Master Thesis. College Of Biotechnology Birsa Agricultural University, Ranchi, India.
Lapuz RR, Javier S, Aquino JDC, Undan JR. 2019. Gene expression and sequence analysis of BADH1 gene in CLSU aromatic rice (Oryza sativa L.) accessions subjected to drought and saline condition. J. of Nutr. Sci. and Vitaminology, 65:S196-199. https://doi.org/10.3177/jnsv.65.S196
Lata C and Prasad M. 2011. Role of DREBs in regulation of abiotic stress responses in plants. J. Exp. Bot. 62, 4731–4748. DOI: 10.1093/jxb/err210
Lanceras J C, Pantuwan GP, Jongdee B, and Toojinda T. 2004. Quantitative trait loci associated with drought tolerance at reproductive stage in rice. Plant Physiol. 135:384-399.
Lathif Y, Listyorini D, Suharti. 2018. Varietas padi lokal jawa timur tahan cekaman kekeringan berdasarkan gen DREB2A. Biotropika: J. of Trop. Biol. 6(3):89-95.
Mizoi J, Shinozaki K, Shinozaki KY. 2012. AP2/ERF family transcription factors in plant abiotic stress responses. Biochim. Biophys. Acta. 1819:86–96. DOI: 10.1016/j.bbagrm.2011.08.004
Matsukura S, Mizoi J, Yoshida T, Todaka D, Ito Y, Maruyama K. 2010. Comprehensive analysis of rice DREB2-type genes that encode transcription factors involved in the expression of abiotic stress-responsive genes. Mol. Genet. Genomics 283, 185–196. DOI: 10.1007/s00438-009-0506-y
McCouch SR, Teytelam L, Xu Y, Lobos KB, Clare K, Walton M, Fu B, Maghirang R, Li Z, Xing Y, Zhang Q, Kono I, Yano M, Fjellstrom R, DeClerk G, Schneider D, Cartinhour S, Ware D, Stein L. 2002. Development and mapping of 2240 new SSR markers for rice (Oryza sativa L). DNA Res. 9:199–207.
Peng S and G.S. Khush. 2003. Four decades of breeding for varietal improvement of irrigated lowland rice in the International Rice Research Institute. Plant Prod. Sci. 6:157-164.
Peng S Khush GS, Virk P, Tang Q, and Zou Y. 2008. Progress in ideotype breeding to increase rice yield potential. Field Crops Res. 108:32–38
Price A H, Cairns JE, Horton P, Jones HG, and Griffiths H. 2002. Linking drought resistance mechanisms to drought avoidance in upland rice using a QTL approach: progress and new opportunities to integrate stomatal and mesophyll responses (rev). J. of Exp. Botany. 53(371): 989-1004.
Qin F, Shinozaki K, Yamaguchi-Shinozaki K. 2011. Achievements and challenges in understanding plant abiotic stress responses and tolerance. Plant Cell Physiol. 52(9): 1569–82.
Robin S, Pathan MS,Courtois B, Lafitte R, Carandang S, Lanceras S, Amante M, Nguyen HT, Li Z. 2003. Mapping osmotic adjustment in an advanced back-cross inbred population of rice. Theor Appl Genet. 107:1288–1296. DOI 10.1007/s00122-003-1360-7
Sakamoto A, and Murata N. 2000. Genetic engineering of glycine betaine synthesis in plants: current status and implications for enhancement of stress tolerance. J. Exp. Bot. 51: 81-88.
Sakuma Y, Liu Q, Dubouzet JG, Abe H, Yamaguchi-Shinozaki K, Shinozaki K. 2002. DNA-binding specificity of the ERF/AP2 domain of Arabidopsis DREBs, transcription factors involved in dehydration- and cold-inducible gene expression. Biochemical and Biophysical Research Commun. 290(3): 998–1009.
Sakuma Y, Maruyama K, Osakabe Y, Qin F, Seki M, Shinozaki K, Yamaguchi-Shinozaki K. 2006. Functional analysis of an Arabidopsis transcription factor, DREB2A, involved in drought-responsive gene expression. Plant Cell 18(5): 1292–1309.
Saxena R, Kumar M, and Tomar RS. 2019. Plant responses and resilience towards drought and salinity stress. Plant Archives 19(2):50-58.
Sevanto S. 2018. Drought impacts on phloem transport. Current Opinion in Plant Biol., 43:76–81. http://dx.doi.org/10.1016/j.pbi.2018.01.002
Shrestha K. 2011. Analysis of betaine aldehyde dehydrogenase encoding genes in wheat, Master Thesis, Southern Cross University, Lismore, NSW.
Srivastav A, Mehta S, Lindlof A, and Bhargava S. 2010. Over-represented promoter motifs in abiotic stress-induced DREB genes of rice and sorghum and their probable role in regulation of gene expression. Plant Signal. Behav. 5:775–784. DOI: 10.4161/psb.5.7.11769
Swain P, Baig MJ, Dash SK, Tripathi R, and Mandal NP. 2017. Drought Tolerance. ICAR Nasional Rice Research Institute. Pp1-20. https://krishi.icar.gov.in/jspui/
Tawfik RS, Badr A, Sammour R, Ibrahim U, Matter M , and Sakr M. 2016. Improvement of Flax Drought Tolerance Using Gene Transfer. Plant Tissue Cult. & Biotech. 26(2): 197?207
Wang X, Liu H, Yu F, Hu B, Jia Y, Sha H, and Zhao H. 2019. Differential activity of the antioxidant defence system and alterations in the accumulation of osmolyte and reactive oxygen species under drought stress and recovery in rice (Oryza sativa L.) tillering. Sci Rep 9, 8543 (2019). https://doi.org/10.1038/s41598-019-44958-x
Zivcak M, Brestic M, Sytar O. 2016. Osmotic Adjustment and Plant Adaptation to Drought Stress. In: Hossain M., Wani S., Bhattacharjee S., Burritt D., Tran LS. (eds) Drought Stress Tolerance in Plants, Vol 1. Springer, Cham, pp 105-143.
Zou L, Xue-hui S,Zhi-guo Z, Peng L, Jin-xia W, Cai-juan T, Jin-long Q, Tie-gang L. 2011. Leaf rolling controlled by the homeodomain leucine zipper class IV gene Roc5 in rice. Plant Physiol. 156:1589– 1602
Bernier J, Kumar A, Ramaiah V, Spaner D, Atlin G. 2007. A large-effect QTL for grain yield under reproductive-stage drought stress in upland rice. Crop Sci. 47:507-517.
Bian Y, Deng X, Yan X, Zhou J, Yuan L, Yan Y. 2017. Integrated proteomic analysis of Brachypodium distachyon roots and leaves reveals a synergistic network in the response to drought stress and recovery. Sci. Reports 7,46183. https://doi.org/10.1038/srep46183
Blum A. 2017. Osmotic adjustment is a prime drought stress adaptive engine in support of plant production. Plant, Cell and Environ. 40:4–10. https://doi.org/10.1111/pce.12800
Bunnag S and Pongthai P. 2013. Selection of rice (Oryza satival.) cultivars tolerant to drought stress at the vegetative stage under field conditions. American J. of Plant Sci, 4:1701-1708.
Cui M, Zhang W, Zhang Q, Xu Z, Zhu Z, Duan F, Wu R. 2011. Induced over-expression of the transcription factor OsDREB2A improves drought tolerance in rice. Plant Physiol. Biochem. 49, 1384–1391. doi: 10.1016/j.plaphy.2011.09.012
Demiral T and Türkan I. 2004. Does exogenous glycinebetaine affect antioxidative system of rice seedlings under NaCl treatment. J. Plant Physiol. 6: 1089-1100.
Mulyaningsih ES, Aswidinnoor H, Sopandie D, Pieter BF, Ouwerkerk, Loedin HIS. 2010. Toleransi genotipe padi gogo dengan marka qtl 12.1 terhadap kekeringan. Jurnal Penelitian Pertanian Tanaman Pangan. 72-81.
Fujita Y, Yoshida T, Yamaguchi SK. 2013. Privotal role of the AREB/ABF-SnRK2 pathway in abremediated transcriptional in response to osmotic stress in plants. Physiol. Plantarum. 147(1): 15–27.
Hasthanasombut S, Paisarnwipatpong N, Triwitayakorn K, Kirdmanee C, Supaibulwatana K. 2011. Expression of OsBADH1 gene in Indica rice (Oryza sativa L.) in correlation with salt, plasmolysis, temperature and light stresses. Plant Omics J. 4(7):400-407.
Herawati R, Masdar, Ganefianti DW, Hermawan B, Alnopri. 2017. Screening and identification of upland rice lines derived recurrent selection for drought tolerance. Intl. J. on Adv. Sci. Eng. Inform Tech. 7(6):2322-2327.
Holmström KO, Somersalo S, Mandal A, Palva TE, Welin B. 2000. Improvement tolerance to salinity and low temperature in transgenic tobacco producing glycine betaine. J Exp Bot. 51: 177-185.
Huang L, Wang Y, Wang W, Zhao X, Qin Q, Sun F, Hu F, Zhao Y, Li Z, Fu B, Li Z. 2018. Characterization of transcription factor gene OsDRAP1 conferring drought tolerance in rice. Front. Plant Sci. 9(94):1-15 doi: 10.3389/fpls.2018.00094
Huang S, Zuo T, Ni W. 2020. Important roles of glycine betaine in stabilizing the structure and function of the photosystem II complex under abiotic stresses. Planta. 251, 36. https://doi.org/10.1007/s00425-019-03330-z
International Rice Research Institute (IRRI). 2002. Standard Evaluation System for Rice. International Rice Testing Program. The International Rice Testing Program (IRTP) IRRI Los Banos, Philippines.
Jadhao KR, Samal KC, Pradhan SK, Rout GR. 2014. Studies on molecular characterization of DREB gene in indica rice (Oryza sativa L.). Hereditary Genet. 3(3): 1–12. DOI:10.4172/2161-1041.1000133.
Kahraman M, Sevim G, Bor M. 2019. The role of proline, glycinebetaine, and trehalose in stress-responsive gene expression. In: Hossain M., Kumar V., Burritt D., Fujita M., Mäkelä P. (eds) Osmoprotectant-Mediated Abiotic Stress Tolerance in Plants. Springer, Cham.
Kumar S, Dwivedi SK, Singh SS, Jha SK, Lekshmy S, Elanchezhian R, Singh ON, and Bhatt BP. 2014. Identification of drought tolerant rice genotypes by analyzing drought tolerance indices and morpho-physiological traits. SABRAO J. of Breed and Gen 46(2):217-230. 2014.
Kumar S, Dwivedi SK, Haris AA, Prakash V, Mondal S, Singh SK. 2015. Screening and identification of rice genotypes for drought tolerance at reproductive stage under rainfed lowland condition. J. of Agri Search 2(2): 105-111.
Kumar S. 2016. Identification of DREB and SSR linked drought sequences in finger millet (Eleusine coracana L.) Gaertn.) genotypes. Master Thesis. College Of Biotechnology Birsa Agricultural University, Ranchi, India.
Lapuz RR, Javier S, Aquino JDC, Undan JR. 2019. Gene expression and sequence analysis of BADH1 gene in CLSU aromatic rice (Oryza sativa L.) accessions subjected to drought and saline condition. J. of Nutr. Sci. and Vitaminology, 65:S196-199. https://doi.org/10.3177/jnsv.65.S196
Lata C and Prasad M. 2011. Role of DREBs in regulation of abiotic stress responses in plants. J. Exp. Bot. 62, 4731–4748. DOI: 10.1093/jxb/err210
Lanceras J C, Pantuwan GP, Jongdee B, and Toojinda T. 2004. Quantitative trait loci associated with drought tolerance at reproductive stage in rice. Plant Physiol. 135:384-399.
Lathif Y, Listyorini D, Suharti. 2018. Varietas padi lokal jawa timur tahan cekaman kekeringan berdasarkan gen DREB2A. Biotropika: J. of Trop. Biol. 6(3):89-95.
Mizoi J, Shinozaki K, Shinozaki KY. 2012. AP2/ERF family transcription factors in plant abiotic stress responses. Biochim. Biophys. Acta. 1819:86–96. DOI: 10.1016/j.bbagrm.2011.08.004
Matsukura S, Mizoi J, Yoshida T, Todaka D, Ito Y, Maruyama K. 2010. Comprehensive analysis of rice DREB2-type genes that encode transcription factors involved in the expression of abiotic stress-responsive genes. Mol. Genet. Genomics 283, 185–196. DOI: 10.1007/s00438-009-0506-y
McCouch SR, Teytelam L, Xu Y, Lobos KB, Clare K, Walton M, Fu B, Maghirang R, Li Z, Xing Y, Zhang Q, Kono I, Yano M, Fjellstrom R, DeClerk G, Schneider D, Cartinhour S, Ware D, Stein L. 2002. Development and mapping of 2240 new SSR markers for rice (Oryza sativa L). DNA Res. 9:199–207.
Peng S and G.S. Khush. 2003. Four decades of breeding for varietal improvement of irrigated lowland rice in the International Rice Research Institute. Plant Prod. Sci. 6:157-164.
Peng S Khush GS, Virk P, Tang Q, and Zou Y. 2008. Progress in ideotype breeding to increase rice yield potential. Field Crops Res. 108:32–38
Price A H, Cairns JE, Horton P, Jones HG, and Griffiths H. 2002. Linking drought resistance mechanisms to drought avoidance in upland rice using a QTL approach: progress and new opportunities to integrate stomatal and mesophyll responses (rev). J. of Exp. Botany. 53(371): 989-1004.
Qin F, Shinozaki K, Yamaguchi-Shinozaki K. 2011. Achievements and challenges in understanding plant abiotic stress responses and tolerance. Plant Cell Physiol. 52(9): 1569–82.
Robin S, Pathan MS,Courtois B, Lafitte R, Carandang S, Lanceras S, Amante M, Nguyen HT, Li Z. 2003. Mapping osmotic adjustment in an advanced back-cross inbred population of rice. Theor Appl Genet. 107:1288–1296. DOI 10.1007/s00122-003-1360-7
Sakamoto A, and Murata N. 2000. Genetic engineering of glycine betaine synthesis in plants: current status and implications for enhancement of stress tolerance. J. Exp. Bot. 51: 81-88.
Sakuma Y, Liu Q, Dubouzet JG, Abe H, Yamaguchi-Shinozaki K, Shinozaki K. 2002. DNA-binding specificity of the ERF/AP2 domain of Arabidopsis DREBs, transcription factors involved in dehydration- and cold-inducible gene expression. Biochemical and Biophysical Research Commun. 290(3): 998–1009.
Sakuma Y, Maruyama K, Osakabe Y, Qin F, Seki M, Shinozaki K, Yamaguchi-Shinozaki K. 2006. Functional analysis of an Arabidopsis transcription factor, DREB2A, involved in drought-responsive gene expression. Plant Cell 18(5): 1292–1309.
Saxena R, Kumar M, and Tomar RS. 2019. Plant responses and resilience towards drought and salinity stress. Plant Archives 19(2):50-58.
Sevanto S. 2018. Drought impacts on phloem transport. Current Opinion in Plant Biol., 43:76–81. http://dx.doi.org/10.1016/j.pbi.2018.01.002
Shrestha K. 2011. Analysis of betaine aldehyde dehydrogenase encoding genes in wheat, Master Thesis, Southern Cross University, Lismore, NSW.
Srivastav A, Mehta S, Lindlof A, and Bhargava S. 2010. Over-represented promoter motifs in abiotic stress-induced DREB genes of rice and sorghum and their probable role in regulation of gene expression. Plant Signal. Behav. 5:775–784. DOI: 10.4161/psb.5.7.11769
Swain P, Baig MJ, Dash SK, Tripathi R, and Mandal NP. 2017. Drought Tolerance. ICAR Nasional Rice Research Institute. Pp1-20. https://krishi.icar.gov.in/jspui/
Tawfik RS, Badr A, Sammour R, Ibrahim U, Matter M , and Sakr M. 2016. Improvement of Flax Drought Tolerance Using Gene Transfer. Plant Tissue Cult. & Biotech. 26(2): 197?207
Wang X, Liu H, Yu F, Hu B, Jia Y, Sha H, and Zhao H. 2019. Differential activity of the antioxidant defence system and alterations in the accumulation of osmolyte and reactive oxygen species under drought stress and recovery in rice (Oryza sativa L.) tillering. Sci Rep 9, 8543 (2019). https://doi.org/10.1038/s41598-019-44958-x
Zivcak M, Brestic M, Sytar O. 2016. Osmotic Adjustment and Plant Adaptation to Drought Stress. In: Hossain M., Wani S., Bhattacharjee S., Burritt D., Tran LS. (eds) Drought Stress Tolerance in Plants, Vol 1. Springer, Cham, pp 105-143.
Zou L, Xue-hui S,Zhi-guo Z, Peng L, Jin-xia W, Cai-juan T, Jin-long Q, Tie-gang L. 2011. Leaf rolling controlled by the homeodomain leucine zipper class IV gene Roc5 in rice. Plant Physiol. 156:1589– 1602
Most read articles by the same author(s)
- SUKMAWATI SUKMAWATI, FEBRIANTI ROSALINA, SIPRIYADI, NURUL KUSUMA DEWI, MELDA YUNITA, ABDUL RIDHA TAHA SARHAN, YENI RAHAYU, EKO KUSUMAWATI, Short Communication: Bacterial diversity of mangrove ecosystem in Klawalu Sorong, West Papua, Indonesia , Biodiversitas Journal of Biological Diversity: Vol. 23 No. 3 (2022)
- MIMI SUTRAWATI, SRI HENDRASTUTI HIDAYAT, GEDE SUASTIKA, BONNY PURNOMO WAHYU SUKARNO, ALI NURMANSYAH, Seed-transmission of Cowpea mild mottle virus on several varieties of soybean in Indonesia , Biodiversitas Journal of Biological Diversity: Vol. 22 No. 10 (2021)
- SUKMAWATI SUKMAWATI, SIPRIYADI, MELDA YUNITA, NURUL KUSUMA DEWI, ERIN D. NOYA, Analysis of bacteriocins of lactic acid bacteria isolated from fermentation of rebon shrimp (Acetes sp.) in South Sorong, Indonesia as antibacterial agents , Biodiversitas Journal of Biological Diversity: Vol. 23 No. 7 (2022)
- LILISTI, ZAMDIAL , DEDE HARTONO, BIENG BRATA, MARULAK SIMARMATA, The structure and composition of macrozoobenthos community in varying water qualities in Kalibaru Waters, Bengkulu, Indonesia , Biodiversitas Journal of Biological Diversity: Vol. 22 No. 1 (2021)
- SUKMAWATI SUKMAWATI, RATNA RATNA, SIPRIYADI, MELDA YUNITA, Characterization and molecular identification of bacteria from mackerel bekasam in Sorong City, Southwest Papua Province, Indonesia , Biodiversitas Journal of Biological Diversity: Vol. 24 No. 9 (2023)
- RENY HERAWATI, MARULAK SIMARMATA, MASDAR, BAMBANG S. PURWOKO, MISWATI, Systematic assessment of salt tolerance based on morpho-physiological traits and genes related in inbred rice lines at the seedling stage , Biodiversitas Journal of Biological Diversity: Vol. 25 No. 1 (2024)
- RAHMAD LINGGA, SUDIRMAN ADIBRATA, OCCA ROANISCA, SIPRIYADI, RISKY HADI WIBOWO, AHMAD ARSYADI, Probiotics potential of lactic acid bacteria isolated from Slender Walking Catfish (Clarias nieuhofii) , Biodiversitas Journal of Biological Diversity: Vol. 24 No. 8 (2023)
- SUKMAWATI SUKMAWATI, SIPRIYADI, FEBRIANTI ROSALINA, RATNA, NURUL KUSUMA DEWI, MOHD IHWAN BIN ZAKARIAH, Identification of 16S rRNA genes in bacteriocin-producing bacteria , Biodiversitas Journal of Biological Diversity: Vol. 25 No. 10 (2024)
- DEBIE RIZQOH, SIPRIYADI, UTARI HARTATI SURYANI, CINTYA NABILA PUTRI, MEUTIA AGUSTIN, HERNITA TAURUSTYA, NOVRIANTIKA LESTARI, MARDHATILLAH SARIYANTI, Exploring the antibacterial activity of endophytic bacteria from Andaliman (Zanthoxylum acanthopodium DC.) against Bacillus subtilis , Biodiversitas Journal of Biological Diversity: Vol. 25 No. 2 (2024)